Transcript: Human XM_017006287.1

PREDICTED: Homo sapiens kyphoscoliosis peptidase (KY), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KY (339855)
Length:
10750
CDS:
4917..7094

Additional Resources:

NCBI RefSeq record:
XM_017006287.1
NBCI Gene record:
KY (339855)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006287.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147116 CCTCTACAATGAGTTCTACTT pLKO.1 6005 CDS 100% 4.950 6.930 N KY n/a
2 TRCN0000417691 ACCGGAATGTCCCATTCAAAT pLKO_005 6883 CDS 100% 13.200 10.560 N KY n/a
3 TRCN0000147147 CAGCAGTTTGAGAAATTGGAT pLKO.1 5556 CDS 100% 3.000 2.400 N KY n/a
4 TRCN0000421926 GTCCGAAGATGGCAGAAATTA pLKO_005 5253 CDS 100% 15.000 10.500 N KY n/a
5 TRCN0000435011 GAAACTACATCTTCGTCTTTA pLKO_005 6745 CDS 100% 13.200 9.240 N KY n/a
6 TRCN0000418126 GGGATCGATCTAGCCTGAAAT pLKO_005 5518 CDS 100% 13.200 9.240 N KY n/a
7 TRCN0000417963 CTCACAAGCTGCAGATCTTTG pLKO_005 6340 CDS 100% 10.800 7.560 N KY n/a
8 TRCN0000130490 GAGGCAGTTTGAGAACAACAT pLKO.1 6107 CDS 100% 4.950 3.465 N KY n/a
9 TRCN0000131189 GAGTTTGACCATGCCTGGAAT pLKO.1 5898 CDS 100% 4.950 3.465 N KY n/a
10 TRCN0000149740 GCCATCACATAGAGTATGACA pLKO.1 5689 CDS 100% 3.000 2.100 N KY n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006287.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.