Transcript: Human XM_017006509.1

PREDICTED: Homo sapiens contactin 3 (CNTN3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CNTN3 (5067)
Length:
3627
CDS:
34..1794

Additional Resources:

NCBI RefSeq record:
XM_017006509.1
NBCI Gene record:
CNTN3 (5067)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006509.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149329 GCTGCTGACTTTGATATGTAT pLKO.1 2945 3UTR 100% 5.625 4.500 N CNTN3 n/a
2 TRCN0000148643 CCACCCTATGTCAAGTTATAT pLKO.1 1734 CDS 100% 15.000 10.500 N CNTN3 n/a
3 TRCN0000183147 GCTCTATTGTTTCATGTTGTT pLKO.1 3468 3UTR 100% 4.950 3.465 N CNTN3 n/a
4 TRCN0000146419 CCTCAGAAATTGAGGTTTCAT pLKO.1 1154 CDS 100% 0.563 0.394 N CNTN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006509.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.