Transcript: Human XM_017006665.2

PREDICTED: Homo sapiens SID1 transmembrane family member 1 (SIDT1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SIDT1 (54847)
Length:
4890
CDS:
1058..3019

Additional Resources:

NCBI RefSeq record:
XM_017006665.2
NBCI Gene record:
SIDT1 (54847)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006665.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435069 TCGCCCTCTTTGGATTGATAT pLKO_005 2625 CDS 100% 13.200 18.480 N SIDT1 n/a
2 TRCN0000141623 CGAGCAGTTCTTCGTGGTATT pLKO.1 1285 CDS 100% 10.800 15.120 N SIDT1 n/a
3 TRCN0000415343 ACGTGGACTCAGTTATCATTA pLKO_005 1191 CDS 100% 13.200 9.240 N SIDT1 n/a
4 TRCN0000141920 CCGGACCAAGATGTTCCTTTA pLKO.1 1774 CDS 100% 10.800 7.560 N SIDT1 n/a
5 TRCN0000122484 CGAGTGCATTCTGCTGGATTT pLKO.1 2875 CDS 100% 10.800 7.560 N SIDT1 n/a
6 TRCN0000142012 GCACCGAGAACATCTACTCTT pLKO.1 902 5UTR 100% 4.950 3.465 N SIDT1 n/a
7 TRCN0000142601 GTGACCATTGTCCCTTCCATT pLKO.1 1403 CDS 100% 4.950 3.465 N SIDT1 n/a
8 TRCN0000074123 CGCCTGTAATCCCAACACTTT pLKO.1 4720 3UTR 100% 4.950 2.475 Y GJD4 n/a
9 TRCN0000166650 CGCCTGTAATCCCAACACTTT pLKO.1 4720 3UTR 100% 4.950 2.475 Y C9orf85 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006665.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.