Transcript: Human XM_017006796.1

PREDICTED: Homo sapiens large 60S subunit nuclear export GTPase 1 (LSG1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LSG1 (55341)
Length:
2900
CDS:
118..1620

Additional Resources:

NCBI RefSeq record:
XM_017006796.1
NBCI Gene record:
LSG1 (55341)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006796.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423998 GAGTTACTGGAGCTCTTTAAG pLKO_005 745 CDS 100% 13.200 18.480 N LSG1 n/a
2 TRCN0000439044 CACGCACCAACATGGAGAAAC pLKO_005 1860 3UTR 100% 10.800 15.120 N LSG1 n/a
3 TRCN0000162074 CCAGATAGTAGATGCTCGAAA pLKO.1 177 CDS 100% 4.950 6.930 N LSG1 n/a
4 TRCN0000163627 GCTAGGGATTCTCCTTCACTT pLKO.1 505 CDS 100% 4.950 6.930 N LSG1 n/a
5 TRCN0000219926 CACTGGTTATTCCACTTATTT pLKO.1 2278 3UTR 100% 15.000 12.000 N LSG1 n/a
6 TRCN0000219925 ACAGGGAAGCTGCGGTATTTA pLKO.1 2239 3UTR 100% 15.000 10.500 N LSG1 n/a
7 TRCN0000414436 GTTTCGACCAGGCTGAAATTT pLKO_005 458 CDS 100% 15.000 10.500 N LSG1 n/a
8 TRCN0000160046 CCTATGGCATTAACATCATAA pLKO.1 1100 CDS 100% 13.200 9.240 N LSG1 n/a
9 TRCN0000427136 GATGGTTCACGAGACACATTT pLKO_005 2077 3UTR 100% 13.200 9.240 N LSG1 n/a
10 TRCN0000431903 GGTGAAAGATGGGCAACTTAC pLKO_005 786 CDS 100% 10.800 7.560 N LSG1 n/a
11 TRCN0000161473 GAGATCATGTTCCTCCTGTAT pLKO.1 1037 CDS 100% 4.950 3.465 N LSG1 n/a
12 TRCN0000161893 GCCAATAAGGAGAACGTCATT pLKO.1 250 CDS 100% 4.950 3.465 N LSG1 n/a
13 TRCN0000416103 TCATCTGGGAGCCCGAGAATC pLKO_005 1814 3UTR 100% 3.600 2.520 N LSG1 n/a
14 TRCN0000162738 CTCCTGTTTAGATGTGAGGAT pLKO.1 202 CDS 100% 2.640 1.848 N LSG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006796.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.