Transcript: Human XM_017006985.1

PREDICTED: Homo sapiens roundabout guidance receptor 1 (ROBO1), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ROBO1 (6091)
Length:
6589
CDS:
308..4915

Additional Resources:

NCBI RefSeq record:
XM_017006985.1
NBCI Gene record:
ROBO1 (6091)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006985.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330248 TGACACATGACGCCAGATAAA pLKO_005 4979 3UTR 100% 13.200 10.560 N ROBO1 n/a
2 TRCN0000330183 ATAGCGAAGAGTACAACATTT pLKO_005 3552 CDS 100% 13.200 9.240 N ROBO1 n/a
3 TRCN0000330182 ATCATCACAAAGGCATATTTG pLKO_005 1268 CDS 100% 13.200 9.240 N ROBO1 n/a
4 TRCN0000330247 ATCTCATCCAAGAGGATATTC pLKO_005 4692 CDS 100% 13.200 9.240 N ROBO1 n/a
5 TRCN0000060413 GCAGAAATACAGTCACATTAT pLKO.1 1677 CDS 100% 13.200 9.240 N ROBO1 n/a
6 TRCN0000060417 GCCACCAGCAAGGATGTATTT pLKO.1 3613 CDS 100% 13.200 9.240 N ROBO1 n/a
7 TRCN0000330180 TTGCTGCCGAGTGGATCTTTA pLKO_005 311 CDS 100% 13.200 9.240 N ROBO1 n/a
8 TRCN0000060416 GCCCACCATTTCATGGAAGAA pLKO.1 547 CDS 100% 4.950 3.465 N ROBO1 n/a
9 TRCN0000060414 GCTGGCAAATATGTTTGTGTT pLKO.1 653 CDS 100% 4.950 3.465 N ROBO1 n/a
10 TRCN0000060415 GCAGACAAAGAGAACAAGCAA pLKO.1 4800 CDS 100% 3.000 2.100 N ROBO1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006985.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.