Transcript: Human XM_017007018.1

PREDICTED: Homo sapiens ring finger protein 123 (RNF123), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF123 (63891)
Length:
4275
CDS:
107..4051

Additional Resources:

NCBI RefSeq record:
XM_017007018.1
NBCI Gene record:
RNF123 (63891)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007018.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232880 TGCAGAGCTATGCGGATTATA pLKO_005 3741 CDS 100% 15.000 21.000 N RNF123 n/a
2 TRCN0000232877 ATGTGACCACAACGAATTATG pLKO_005 651 CDS 100% 13.200 18.480 N RNF123 n/a
3 TRCN0000033894 GCGCTACTATTGGGATGAATA pLKO.1 1801 CDS 100% 13.200 18.480 N RNF123 n/a
4 TRCN0000232878 GGGTGAAGCTTCTAGGTATAT pLKO_005 1663 CDS 100% 13.200 18.480 N RNF123 n/a
5 TRCN0000033895 GCGGATTATATCAGTGCCGAT pLKO.1 3752 CDS 100% 2.160 3.024 N RNF123 n/a
6 TRCN0000232879 CAAACTTGAGGACGCCAATTT pLKO_005 3082 CDS 100% 13.200 9.240 N RNF123 n/a
7 TRCN0000232881 AGCCAGGCTGGGCCCTATTTA pLKO_005 4097 3UTR 100% 5.000 3.500 N RNF123 n/a
8 TRCN0000033897 GCAAGTGGAATGTGACCACAA pLKO.1 642 CDS 100% 4.050 2.835 N RNF123 n/a
9 TRCN0000033898 GCCAGAACATTTGGACCAGTT pLKO.1 298 CDS 100% 4.050 2.835 N RNF123 n/a
10 TRCN0000033896 CCCTCAAAGATGACCTTGCTT pLKO.1 1950 CDS 100% 3.000 2.100 N RNF123 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007018.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.