Transcript: Human XM_017007164.2

PREDICTED: Homo sapiens sarcolemma associated protein (SLMAP), transcript variant X37, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLMAP (7871)
Length:
6103
CDS:
1219..3522

Additional Resources:

NCBI RefSeq record:
XM_017007164.2
NBCI Gene record:
SLMAP (7871)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007164.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422644 GGCCTTACATCGGGAACAAAT pLKO_005 1740 CDS 100% 13.200 18.480 N SLMAP n/a
2 TRCN0000419672 AGCTGTAGGGTCATTGCTTTA pLKO_005 3743 3UTR 100% 10.800 15.120 N SLMAP n/a
3 TRCN0000424252 GATCGTCGAAGGGCATCTAAC pLKO_005 2424 CDS 100% 10.800 15.120 N SLMAP n/a
4 TRCN0000138432 CAAGCCCAATTGCAGAGGTTA pLKO.1 2689 CDS 100% 4.950 6.930 N SLMAP n/a
5 TRCN0000137436 GCAGCGTCTGAATATGAGAAA pLKO.1 2908 CDS 100% 4.950 6.930 N SLMAP n/a
6 TRCN0000419273 GTTTACGAAAGGAACTTATAG pLKO_005 1922 CDS 100% 13.200 9.240 N SLMAP n/a
7 TRCN0000428502 GATGTCATCCATGCACCATTA pLKO_005 1636 CDS 100% 10.800 7.560 N SLMAP n/a
8 TRCN0000137225 GCAAGGTGAACTAGAGAAGTT pLKO.1 3009 CDS 100% 4.950 3.465 N SLMAP n/a
9 TRCN0000137099 CAAATGGATGAGCAAGACCTA pLKO.1 2563 CDS 100% 2.640 1.848 N SLMAP n/a
10 TRCN0000136539 CCAATGAAAGGCTAACAGCTT pLKO.1 2327 CDS 100% 2.640 1.848 N SLMAP n/a
11 TRCN0000133854 GCTTCTTTACAAGAAGAGCTT pLKO.1 2851 CDS 100% 0.264 0.185 N SLMAP n/a
12 TRCN0000193757 CAATTCTCAGAAGCAGAGTTT pLKO.1 3129 CDS 100% 4.950 2.970 N Slmap n/a
13 TRCN0000176237 GCCTATCGAAATCAAGTTGAA pLKO.1 2641 CDS 100% 4.950 6.930 N Slmap n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007164.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.