Transcript: Human XM_017007425.1

PREDICTED: Homo sapiens ubiquitin specific peptidase 13 (USP13), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
USP13 (8975)
Length:
3111
CDS:
16..2517

Additional Resources:

NCBI RefSeq record:
XM_017007425.1
NBCI Gene record:
USP13 (8975)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007425.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007251 CGATTTAAATAGCGACGATTA pLKO.1 297 CDS 100% 10.800 15.120 N USP13 n/a
2 TRCN0000279829 CGATTTAAATAGCGACGATTA pLKO_005 297 CDS 100% 10.800 15.120 N USP13 n/a
3 TRCN0000007249 GCCAGTATCTAAATATGCCAA pLKO.1 483 CDS 100% 2.640 2.112 N USP13 n/a
4 TRCN0000279837 GCCAGTATCTAAATATGCCAA pLKO_005 483 CDS 100% 2.640 2.112 N USP13 n/a
5 TRCN0000007250 CGCCTGATGAACCAATTGATA pLKO.1 1849 CDS 100% 5.625 3.938 N USP13 n/a
6 TRCN0000007252 CCGGTGAAATCTGAACTCATT pLKO.1 1132 CDS 100% 4.950 3.465 N USP13 n/a
7 TRCN0000297729 CCGGTGAAATCTGAACTCATT pLKO_005 1132 CDS 100% 4.950 3.465 N USP13 n/a
8 TRCN0000007248 GCAGATAAAGAAGTTCACTTT pLKO.1 1674 CDS 100% 4.950 2.970 N USP13 n/a
9 TRCN0000297325 GCAGATAAAGAAGTTCACTTT pLKO_005 1674 CDS 100% 4.950 2.970 N USP13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007425.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.