Transcript: Human XM_017007513.1

PREDICTED: Homo sapiens coatomer protein complex subunit beta 2 (COPB2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COPB2 (9276)
Length:
4865
CDS:
639..2597

Additional Resources:

NCBI RefSeq record:
XM_017007513.1
NBCI Gene record:
COPB2 (9276)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007513.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065115 GCCCACGATTCTTCAGAGTAT pLKO.1 1065 CDS 100% 4.950 6.930 N COPB2 n/a
2 TRCN0000286527 GCCCACGATTCTTCAGAGTAT pLKO_005 1065 CDS 100% 4.950 6.930 N COPB2 n/a
3 TRCN0000065117 GCAGATTAGAGTGTTCAATTA pLKO.1 256 5UTR 100% 13.200 10.560 N COPB2 n/a
4 TRCN0000286459 GCAGATTAGAGTGTTCAATTA pLKO_005 256 5UTR 100% 13.200 10.560 N COPB2 n/a
5 TRCN0000065116 CCAGCCAAACAATACCCACTT pLKO.1 2334 CDS 100% 4.050 3.240 N COPB2 n/a
6 TRCN0000382223 ATCCTGAGTTGCCAATCATTA pLKO_005 732 CDS 100% 13.200 9.240 N COPB2 n/a
7 TRCN0000293894 ATTGCTACTGAGGAATCATTT pLKO_005 1311 CDS 100% 13.200 9.240 N COPB2 n/a
8 TRCN0000293939 CCTGACTAAACAGATCATTAT pLKO_005 2617 3UTR 100% 13.200 9.240 N COPB2 n/a
9 TRCN0000293938 TGCTAGATCTGATCGAGTTAA pLKO_005 55 5UTR 100% 13.200 9.240 N COPB2 n/a
10 TRCN0000381886 TTGAAGGACACACCCATTATG pLKO_005 432 5UTR 100% 13.200 9.240 N COPB2 n/a
11 TRCN0000113176 CCCAAAGATAACAATCAGTTT pLKO.1 473 5UTR 100% 4.950 3.465 N Copb2 n/a
12 TRCN0000065114 CCTCAGACTATTCAGCACAAT pLKO.1 939 CDS 100% 4.950 3.465 N COPB2 n/a
13 TRCN0000065113 GCCATTAGTAAATGTCAGTTT pLKO.1 1905 CDS 100% 4.950 3.465 N COPB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007513.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.