Transcript: Human XM_017007646.1

PREDICTED: Homo sapiens ATPase phospholipid transporting 8A1 (ATP8A1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATP8A1 (10396)
Length:
8193
CDS:
627..3650

Additional Resources:

NCBI RefSeq record:
XM_017007646.1
NBCI Gene record:
ATP8A1 (10396)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007646.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426378 ACACCCGACTCGGTGATTATA pLKO_005 1710 CDS 100% 15.000 21.000 N ATP8A1 n/a
2 TRCN0000038443 CGAAGAGAGTTATGAGTTGAT pLKO.1 2054 CDS 100% 4.950 6.930 N ATP8A1 n/a
3 TRCN0000038440 CGACAGTATTTCCTGGACTTA pLKO.1 2427 CDS 100% 4.950 6.930 N ATP8A1 n/a
4 TRCN0000038442 GCTCTCAAATGTGGAACGGAT pLKO.1 992 CDS 100% 2.640 3.696 N ATP8A1 n/a
5 TRCN0000414877 CTATGGTGGCGCTAGTAATTT pLKO_005 1133 CDS 100% 15.000 12.000 N ATP8A1 n/a
6 TRCN0000412954 ACAAGGTAACCAACCATTAAA pLKO_005 4000 3UTR 100% 15.000 10.500 N ATP8A1 n/a
7 TRCN0000038441 CCCAGGCATACTTCATAAATT pLKO.1 1240 CDS 100% 15.000 10.500 N ATP8A1 n/a
8 TRCN0000070217 CCAACTTAGATGGTGAAACAA pLKO.1 691 CDS 100% 5.625 3.938 N Atp8a1 n/a
9 TRCN0000038439 GCCTCCTTTAACTCTTGGAAT pLKO.1 2864 CDS 100% 4.950 3.465 N ATP8A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007646.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.