Transcript: Human XM_017007686.2

PREDICTED: Homo sapiens WD repeat domain 17 (WDR17), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WDR17 (116966)
Length:
7340
CDS:
157..4101

Additional Resources:

NCBI RefSeq record:
XM_017007686.2
NBCI Gene record:
WDR17 (116966)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007686.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370903 AGTACACAAGTCAGCTATTAA pLKO_005 3689 CDS 100% 15.000 21.000 N WDR17 n/a
2 TRCN0000130145 CAGTTGGATCACCGTTATAAT pLKO.1 349 CDS 100% 15.000 21.000 N WDR17 n/a
3 TRCN0000365683 CGGGTAATGAAGGTGTTATTT pLKO_005 1454 CDS 100% 15.000 21.000 N WDR17 n/a
4 TRCN0000370839 GCATTGCCTGGAGTCATAAAG pLKO_005 1610 CDS 100% 13.200 18.480 N WDR17 n/a
5 TRCN0000365685 GTGCGACCCTGGCTATCTATA pLKO_005 323 CDS 100% 13.200 18.480 N WDR17 n/a
6 TRCN0000130117 CTTCACGCAATTATGTCTGAA pLKO.1 379 CDS 100% 4.950 3.960 N WDR17 n/a
7 TRCN0000365766 CTTGACCTACTGAGCTATATT pLKO_005 3541 CDS 100% 15.000 10.500 N WDR17 n/a
8 TRCN0000365686 TGCACCTGTGAGAGGATTAAT pLKO_005 1983 CDS 100% 15.000 10.500 N WDR17 n/a
9 TRCN0000370904 ACCCACTATCTACTGATTATC pLKO_005 851 CDS 100% 13.200 9.240 N WDR17 n/a
10 TRCN0000365763 AGACATACAGTAAGTACTTAA pLKO_005 4470 3UTR 100% 13.200 9.240 N WDR17 n/a
11 TRCN0000128944 CTCAGAGATGCAATGGATAAT pLKO.1 6042 3UTR 100% 13.200 9.240 N WDR17 n/a
12 TRCN0000128792 CAATTTCTTGGTGTCCACATA pLKO.1 419 CDS 100% 4.950 3.465 N WDR17 n/a
13 TRCN0000127681 CAACTCAGAGATGCAATGGAT pLKO.1 6039 3UTR 100% 3.000 2.100 N WDR17 n/a
14 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 5804 3UTR 100% 4.950 2.475 Y ORAI2 n/a
15 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5729 3UTR 100% 13.200 6.600 Y LIAS n/a
16 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 5801 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007686.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.