Transcript: Human XM_017007736.1

PREDICTED: Homo sapiens EvC ciliary complex subunit 2 (EVC2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EVC2 (132884)
Length:
4399
CDS:
284..3970

Additional Resources:

NCBI RefSeq record:
XM_017007736.1
NBCI Gene record:
EVC2 (132884)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007736.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083607 CCTTTCCCTTAACGACCAAAT pLKO.1 1114 CDS 100% 10.800 15.120 N EVC2 n/a
2 TRCN0000083605 CCTATAACACACCGCCTGTAT pLKO.1 476 CDS 100% 4.950 6.930 N EVC2 n/a
3 TRCN0000175077 GACAATGACTTAAAGCAGGAA pLKO.1 2012 CDS 100% 2.640 2.112 N Evc2 n/a
4 TRCN0000415888 CCATATCACAAGGACATAAAC pLKO_005 4168 3UTR 100% 13.200 9.240 N EVC2 n/a
5 TRCN0000083604 GCAGAAACCATTGATCTATTA pLKO.1 3821 CDS 100% 13.200 9.240 N EVC2 n/a
6 TRCN0000422591 GACATCGGGTTTGGCAGTATG pLKO_005 1041 CDS 100% 10.800 7.560 N EVC2 n/a
7 TRCN0000083606 CCTCTCAGAGAGAGGATGATA pLKO.1 3725 CDS 100% 0.563 0.338 N EVC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007736.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.