Transcript: Human XM_017007753.2

PREDICTED: Homo sapiens parkin coregulated like (PACRGL), transcript variant X28, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PACRGL (133015)
Length:
2122
CDS:
176..841

Additional Resources:

NCBI RefSeq record:
XM_017007753.2
NBCI Gene record:
PACRGL (133015)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007753.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130003 GATTGGTACATGGTTCAGTAA pLKO.1 450 CDS 100% 4.950 6.930 N PACRGL n/a
2 TRCN0000127725 GTTCAGCTAAGTGTCGTTGTT pLKO.1 722 CDS 100% 4.950 6.930 N PACRGL n/a
3 TRCN0000128314 GCAACAGGTAACTATGATCAA pLKO.1 221 CDS 100% 4.950 3.960 N PACRGL n/a
4 TRCN0000128497 GCGAAGAACCATTATTGAGTT pLKO.1 1087 3UTR 100% 4.950 3.960 N PACRGL n/a
5 TRCN0000430719 TTTGTAGCTGTGCCCTTATTT pLKO_005 1176 3UTR 100% 15.000 10.500 N PACRGL n/a
6 TRCN0000415570 ACTAACTGTGGGTACTCATTT pLKO_005 891 3UTR 100% 13.200 9.240 N PACRGL n/a
7 TRCN0000435244 ATTTGATCCACTTCTTATTAC pLKO_005 511 CDS 100% 13.200 9.240 N PACRGL n/a
8 TRCN0000425785 ATTCGGATGATGAAGTGTTTG pLKO_005 681 CDS 100% 10.800 7.560 N PACRGL n/a
9 TRCN0000130656 CCTTCTGCATTTGCAGCTATT pLKO.1 404 CDS 100% 10.800 7.560 N PACRGL n/a
10 TRCN0000128424 GCCTTAGCATCATCAAATCTA pLKO.1 789 CDS 100% 5.625 3.938 N PACRGL n/a
11 TRCN0000127623 CTAGACTGATTCCTGTGCTAA pLKO.1 645 CDS 100% 4.950 3.465 N PACRGL n/a
12 TRCN0000129392 GAATGCAGTTCAGGGAAGCAA pLKO.1 274 CDS 100% 3.000 2.100 N PACRGL n/a
13 TRCN0000129445 GACTTCCAAAGTGCTGGGATT pLKO.1 1540 3UTR 100% 4.050 2.025 Y PACRGL n/a
14 TRCN0000162795 CTTCCAAAGTGCTGGGATTAT pLKO.1 1542 3UTR 100% 13.200 6.600 Y SLC48A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007753.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.