Transcript: Human XM_017007768.2

PREDICTED: Homo sapiens zinc finger protein 827 (ZNF827), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF827 (152485)
Length:
7510
CDS:
315..4358

Additional Resources:

NCBI RefSeq record:
XM_017007768.2
NBCI Gene record:
ZNF827 (152485)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007768.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255317 ACCTCATCACCCGGATGTTTG pLKO_005 3430 CDS 100% 10.800 15.120 N Zfp827 n/a
2 TRCN0000230681 GGTGATTCACACAGGTTTAAA pLKO_005 1487 CDS 100% 15.000 10.500 N ZNF827 n/a
3 TRCN0000230680 ATGCCGTTCTGCAGGACAAAT pLKO_005 973 CDS 100% 13.200 9.240 N ZNF827 n/a
4 TRCN0000225885 CTCGCAAGGACAATCTCAAAT pLKO_005 1543 CDS 100% 13.200 9.240 N Zfp827 n/a
5 TRCN0000230682 CTCGCAAGGACAATCTCAAAT pLKO_005 1543 CDS 100% 13.200 9.240 N ZNF827 n/a
6 TRCN0000218356 TGTTAAGATGGCGTCTGATTT pLKO_005 2018 CDS 100% 13.200 9.240 N ZNF827 n/a
7 TRCN0000144574 GAGTTTCTAAACCCTCCAATT pLKO.1 1384 CDS 100% 10.800 7.560 N ZNF827 n/a
8 TRCN0000144745 GAAGAATATCAGCTCCAGAAA pLKO.1 2674 CDS 100% 4.950 3.465 N ZNF827 n/a
9 TRCN0000140808 GTTCAAGACCACACACCCTTT pLKO.1 3890 CDS 100% 4.050 2.835 N ZNF827 n/a
10 TRCN0000143146 CAACTTTGTCTGCAAGACGAA pLKO.1 3380 CDS 100% 2.640 1.848 N ZNF827 n/a
11 TRCN0000140787 GCTGGAGCATAAGAAATGCCA pLKO.1 3494 CDS 100% 0.750 0.525 N ZNF827 n/a
12 TRCN0000143361 GCAGGAACAGAATGACCAATA pLKO.1 842 CDS 100% 10.800 6.480 N ZNF827 n/a
13 TRCN0000219088 TTGTCTGCAAGACGAAGAATA pLKO_005 3385 CDS 100% 13.200 9.240 N Zfp827 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007768.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.