Transcript: Human XM_017007825.1

PREDICTED: Homo sapiens spermatogenesis associated 5 (SPATA5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPATA5 (166378)
Length:
3413
CDS:
70..2823

Additional Resources:

NCBI RefSeq record:
XM_017007825.1
NBCI Gene record:
SPATA5 (166378)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007825.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418340 CCGTACAAGCTGCAAGTATTG pLKO_005 628 CDS 100% 10.800 15.120 N SPATA5 n/a
2 TRCN0000422490 GTTCATCCCATGAAGCGATTT pLKO_005 3093 3UTR 100% 10.800 15.120 N SPATA5 n/a
3 TRCN0000183706 GAGCATAAGTTTCAATCAGTT pLKO.1 3006 3UTR 100% 4.950 6.930 N SPATA5 n/a
4 TRCN0000149650 GCTAATGAAGTTGGAGCCTAT pLKO.1 1291 CDS 100% 4.050 5.670 N SPATA5 n/a
5 TRCN0000425103 ACGGAAAGCAAGAGGTGTATA pLKO_005 344 CDS 100% 13.200 9.240 N SPATA5 n/a
6 TRCN0000182975 CCAAACATGTTGGCATCAATT pLKO.1 3151 3UTR 100% 13.200 9.240 N SPATA5 n/a
7 TRCN0000423522 TCTGACGGTGACCAACTTATT pLKO_005 204 CDS 100% 13.200 9.240 N SPATA5 n/a
8 TRCN0000149738 GCATAGGAGCAAAGTGCAATA pLKO.1 1007 CDS 100% 10.800 7.560 N SPATA5 n/a
9 TRCN0000149306 GCCAAACATGTTGGCATCAAT pLKO.1 3150 3UTR 100% 0.563 0.394 N SPATA5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007825.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.