Transcript: Human XM_017007984.1

PREDICTED: Homo sapiens nephronectin (NPNT), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NPNT (255743)
Length:
4466
CDS:
201..1706

Additional Resources:

NCBI RefSeq record:
XM_017007984.1
NBCI Gene record:
NPNT (255743)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017007984.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055960 GCACAGGTGCATGAACACTTA pLKO.1 647 CDS 100% 4.950 6.930 N NPNT n/a
2 TRCN0000055959 GCCTCCGAAGACACCATATAT pLKO.1 1229 CDS 100% 15.000 10.500 N NPNT n/a
3 TRCN0000055958 GCAGCTTTGCTCGATGTTATA pLKO.1 1021 CDS 100% 13.200 9.240 N NPNT n/a
4 TRCN0000055961 CCTGCCCTAGATTTAGGCAAT pLKO.1 880 CDS 100% 4.050 2.835 N NPNT n/a
5 TRCN0000119315 GCACAGGTGCATGAACACTTT pLKO.1 647 CDS 100% 4.950 6.930 N Npnt n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017007984.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.