Transcript: Human XM_017008267.2

PREDICTED: Homo sapiens protocadherin 7 (PCDH7), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PCDH7 (5099)
Length:
5811
CDS:
1563..5135

Additional Resources:

NCBI RefSeq record:
XM_017008267.2
NBCI Gene record:
PCDH7 (5099)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008267.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055745 CCTTAACATCAAAGACGAGAA pLKO.1 2768 CDS 100% 4.050 5.670 N PCDH7 n/a
2 TRCN0000291728 CCTTAACATCAAAGACGAGAA pLKO_005 2768 CDS 100% 4.050 5.670 N PCDH7 n/a
3 TRCN0000055744 GCAGGAGACAACATTTCAATT pLKO.1 4659 CDS 100% 13.200 9.240 N PCDH7 n/a
4 TRCN0000291662 GCAGGAGACAACATTTCAATT pLKO_005 4659 CDS 100% 13.200 9.240 N PCDH7 n/a
5 TRCN0000055746 CCAAGCTATGAAATTAGCAAA pLKO.1 4167 CDS 100% 4.950 3.465 N PCDH7 n/a
6 TRCN0000291727 CCAAGCTATGAAATTAGCAAA pLKO_005 4167 CDS 100% 4.950 3.465 N PCDH7 n/a
7 TRCN0000055743 GCTGGCATTATGACGGTGATT pLKO.1 4218 CDS 100% 4.950 3.465 N PCDH7 n/a
8 TRCN0000291663 GCTGGCATTATGACGGTGATT pLKO_005 4218 CDS 100% 4.950 3.465 N PCDH7 n/a
9 TRCN0000055747 CGTGCTTGACATCAACGACAA pLKO.1 1958 CDS 100% 4.050 2.835 N PCDH7 n/a
10 TRCN0000307765 CGTGCTTGACATCAACGACAA pLKO_005 1958 CDS 100% 4.050 2.835 N PCDH7 n/a
11 TRCN0000340336 ACTTCGAGGTGTCGGTGATAG pLKO_005 1894 CDS 100% 10.800 15.120 N Pcdh7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008267.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.