Transcript: Human XM_017008474.1

PREDICTED: Homo sapiens capping protein inhibiting regulator of actin dynamics (CRACD), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CRACD (57482)
Length:
7525
CDS:
1180..4707

Additional Resources:

NCBI RefSeq record:
XM_017008474.1
NBCI Gene record:
CRACD (57482)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008474.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268642 AGCGACTGTCCACAGATTATT pLKO_005 4681 CDS 100% 15.000 21.000 N CRACD n/a
2 TRCN0000268640 CCATCGAAAGTGTCAACTTAG pLKO_005 1412 CDS 100% 10.800 15.120 N CRACD n/a
3 TRCN0000283760 ACTCCGAGGAGCCAGGTATTT pLKO_005 2336 CDS 100% 13.200 9.240 N CRACD n/a
4 TRCN0000268682 GAGAAGGTTGCTCCCGTTAAA pLKO_005 1354 CDS 100% 13.200 9.240 N CRACD n/a
5 TRCN0000268643 GTAATGGTGAAAGGATCATAT pLKO_005 5154 3UTR 100% 13.200 9.240 N CRACD n/a
6 TRCN0000376203 ATTGAGAAGGACCAACTATTC pLKO_005 3549 CDS 100% 10.800 7.560 N C530008M17Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008474.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.