Transcript: Human XM_017008481.1

PREDICTED: Homo sapiens sortilin related VPS10 domain containing receptor 2 (SORCS2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SORCS2 (57537)
Length:
5032
CDS:
41..3541

Additional Resources:

NCBI RefSeq record:
XM_017008481.1
NBCI Gene record:
SORCS2 (57537)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008481.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420781 TACGTCTCTTATCGTCGAAAT pLKO_005 1139 CDS 100% 10.800 15.120 N SORCS2 n/a
2 TRCN0000062968 GCAGGACGATTACATCTTCTT pLKO.1 1087 CDS 100% 4.950 6.930 N SORCS2 n/a
3 TRCN0000062970 GCTCTACGTGTCATCTGACTT pLKO.1 853 CDS 100% 4.950 6.930 N SORCS2 n/a
4 TRCN0000433160 GAAAGTGATGACGCTTATAAC pLKO_005 1429 CDS 100% 13.200 9.240 N SORCS2 n/a
5 TRCN0000062969 CCCTTTGAAGATCCTCAAGTT pLKO.1 1783 CDS 100% 4.950 3.465 N SORCS2 n/a
6 TRCN0000062971 GCCGAAGTATGCATTGCCAAA pLKO.1 1180 CDS 100% 4.050 2.835 N SORCS2 n/a
7 TRCN0000062972 GAACGCACAGAAGATCAGCTT pLKO.1 3175 CDS 100% 2.640 1.848 N SORCS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008481.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.