Transcript: Human XM_017008509.1

PREDICTED: Homo sapiens zinc finger FYVE-type containing 28 (ZFYVE28), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZFYVE28 (57732)
Length:
2465
CDS:
375..2450

Additional Resources:

NCBI RefSeq record:
XM_017008509.1
NBCI Gene record:
ZFYVE28 (57732)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008509.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143029 CAGAGATTTCTGCGTCAAGTT pLKO.1 617 CDS 100% 4.950 6.930 N ZFYVE28 n/a
2 TRCN0000244853 TGCTTGCCCGGTTCTACTATG pLKO_005 430 CDS 100% 10.800 8.640 N ZFYVE28 n/a
3 TRCN0000140449 GACGAGATGTCCTCTTTGCTT pLKO.1 1434 CDS 100% 3.000 2.400 N ZFYVE28 n/a
4 TRCN0000244854 CAATGTGTTGAACATCATTAA pLKO_005 557 CDS 100% 13.200 9.240 N ZFYVE28 n/a
5 TRCN0000121886 GTTGAACATCATTAACCAGAT pLKO.1 563 CDS 100% 4.050 2.835 N ZFYVE28 n/a
6 TRCN0000140327 CCAGATCATGGATGAGTGCAT pLKO.1 578 CDS 100% 2.640 1.848 N ZFYVE28 n/a
7 TRCN0000139781 CGTGTTCTTCATGGATGACGT pLKO.1 1571 CDS 100% 2.640 1.848 N ZFYVE28 n/a
8 TRCN0000122609 GCCACCAACTGCCTTCTGCAT pLKO.1 2040 CDS 100% 0.880 0.616 N ZFYVE28 n/a
9 TRCN0000140761 GTACCTGACTCAGGACATGAT pLKO.1 1001 CDS 100% 0.000 0.000 N ZFYVE28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008509.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.