Transcript: Human XM_017008529.2

PREDICTED: Homo sapiens regulator of G protein signaling 12 (RGS12), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RGS12 (6002)
Length:
6047
CDS:
1475..5818

Additional Resources:

NCBI RefSeq record:
XM_017008529.2
NBCI Gene record:
RGS12 (6002)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008529.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423534 GAACACTAGGCAAGTCTAATT pLKO_005 4896 CDS 100% 13.200 18.480 N RGS12 n/a
2 TRCN0000014271 CGAAAGACTAAGGAAGATAAA pLKO.1 3332 CDS 100% 13.200 10.560 N RGS12 n/a
3 TRCN0000423646 ACGTCTGCTCGGAGATCATTT pLKO_005 3404 CDS 100% 13.200 9.240 N RGS12 n/a
4 TRCN0000014272 GCTGGATCTTGTTCCGATTAA pLKO.1 4582 CDS 100% 13.200 9.240 N RGS12 n/a
5 TRCN0000014269 CGGCTTTCAAAGAGAGAAGAA pLKO.1 4961 CDS 100% 4.950 3.465 N RGS12 n/a
6 TRCN0000014270 GCCTTTGGAATGCAAAGCATT pLKO.1 3290 CDS 100% 0.495 0.347 N RGS12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008529.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.