Transcript: Human XM_017008790.1

PREDICTED: Homo sapiens unc-5 netrin receptor C (UNC5C), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UNC5C (8633)
Length:
9524
CDS:
1100..2794

Additional Resources:

NCBI RefSeq record:
XM_017008790.1
NBCI Gene record:
UNC5C (8633)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008790.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421839 GATCCATCCTGTACCGCATTT pLKO_005 1577 CDS 100% 10.800 15.120 N UNC5C n/a
2 TRCN0000062049 GCGCCTGTCAATTCACGATAT pLKO.1 2221 CDS 100% 10.800 15.120 N UNC5C n/a
3 TRCN0000433177 TGGCGTAATCCTGGATCTTTG pLKO_005 2665 CDS 100% 10.800 15.120 N UNC5C n/a
4 TRCN0000062048 CGGAAGAATCATCGTGACTTT pLKO.1 1205 CDS 100% 4.950 6.930 N UNC5C n/a
5 TRCN0000376866 CTGTCCATGGCTCGTTCTATT pLKO_005 3192 3UTR 100% 13.200 9.240 N Unc5c n/a
6 TRCN0000414772 TGATCACAACCTCATCATAAA pLKO_005 658 5UTR 100% 13.200 9.240 N UNC5C n/a
7 TRCN0000071906 CCAATGACCAACTCTCCAATT pLKO.1 1388 CDS 100% 10.800 7.560 N Unc5c n/a
8 TRCN0000062051 GCTGGCTAAATATCAGGAAAT pLKO.1 2269 CDS 100% 10.800 7.560 N UNC5C n/a
9 TRCN0000062052 GCGCATTGCATATCTACGGAA pLKO.1 478 5UTR 100% 2.640 1.848 N UNC5C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008790.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.