Transcript: Human XM_017008955.1

PREDICTED: Homo sapiens follistatin (FST), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FST (10468)
Length:
2721
CDS:
781..1620

Additional Resources:

NCBI RefSeq record:
XM_017008955.1
NBCI Gene record:
FST (10468)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008955.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378688 CAGTACCAAGGCAGATGTAAA pLKO_005 1021 CDS 100% 13.200 9.240 N FST n/a
2 TRCN0000058319 GCCAGTGACAATGCCACTTAT pLKO.1 1438 CDS 100% 13.200 9.240 N FST n/a
3 TRCN0000058321 GCCTACTGTGTGACCTGTAAT pLKO.1 1105 CDS 100% 13.200 9.240 N FST n/a
4 TRCN0000058318 CGTGAATGACAACACACTCTT pLKO.1 753 5UTR 100% 4.950 3.465 N FST n/a
5 TRCN0000058322 CTGTAAAGAAACGTGTGAGAA pLKO.1 816 CDS 100% 4.950 3.465 N FST n/a
6 TRCN0000058320 GCTGGGCAGATCTATTGGATT pLKO.1 1224 CDS 100% 4.950 3.465 N FST n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008955.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.