Transcript: Human XM_017009182.1

PREDICTED: Homo sapiens dynein axonemal heavy chain 5 (DNAH5), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DNAH5 (1767)
Length:
11537
CDS:
18..11447

Additional Resources:

NCBI RefSeq record:
XM_017009182.1
NBCI Gene record:
DNAH5 (1767)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009182.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423418 GCGAGGCATAACTACTTATTT pLKO_005 228 CDS 100% 15.000 21.000 N DNAH5 n/a
2 TRCN0000432321 TACGAGACTCTGATTACTATT pLKO_005 5781 CDS 100% 13.200 18.480 N DNAH5 n/a
3 TRCN0000083410 GCGTTCATATACCAGAATGAA pLKO.1 5940 CDS 100% 0.563 0.788 N DNAH5 n/a
4 TRCN0000430106 ACTGAATATTGAGGCTTATTT pLKO_005 2513 CDS 100% 15.000 10.500 N DNAH5 n/a
5 TRCN0000083412 CGCTTGGTTAATGAGATGTAT pLKO.1 11381 CDS 100% 5.625 3.938 N DNAH5 n/a
6 TRCN0000083411 GCCACAAATGACTGGACTGAT pLKO.1 7047 CDS 100% 4.950 3.465 N DNAH5 n/a
7 TRCN0000083408 GCCAAGATAATAGACATCTTT pLKO.1 1566 CDS 100% 0.563 0.394 N DNAH5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009182.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.