Transcript: Human XM_017009221.2

PREDICTED: Homo sapiens eukaryotic translation termination factor 1 (ETF1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ETF1 (2107)
Length:
3504
CDS:
137..1294

Additional Resources:

NCBI RefSeq record:
XM_017009221.2
NBCI Gene record:
ETF1 (2107)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009221.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000145565 GCCTACAACTAAGTTCCTAAA pLKO.1 1500 3UTR 100% 10.800 15.120 N ETF1 n/a
2 TRCN0000350927 GCCTACAACTAAGTTCCTAAA pLKO_005 1500 3UTR 100% 10.800 15.120 N ETF1 n/a
3 TRCN0000191439 CATAACTATGTTCGGAAAGTA pLKO.1 731 CDS 100% 5.625 7.875 N Etf1 n/a
4 TRCN0000279011 CATAACTATGTTCGGAAAGTA pLKO_005 731 CDS 100% 5.625 7.875 N Etf1 n/a
5 TRCN0000142557 GCCATTGTAAATGGGTCTGAT pLKO.1 3108 3UTR 100% 4.950 6.930 N ETF1 n/a
6 TRCN0000144191 CGACATAACTATGTTCGGAAA pLKO.1 728 CDS 100% 4.050 5.670 N ETF1 n/a
7 TRCN0000338685 CGACATAACTATGTTCGGAAA pLKO_005 728 CDS 100% 4.050 5.670 N ETF1 n/a
8 TRCN0000145600 CAGCACTACTTTCAGATGATA pLKO.1 546 CDS 100% 5.625 3.938 N ETF1 n/a
9 TRCN0000141242 CCTCTCCAACGTGAAATTCAT pLKO.1 958 CDS 100% 5.625 3.938 N ETF1 n/a
10 TRCN0000142237 GAAGGGTCTCAGTTTGTGAAA pLKO.1 1172 CDS 100% 4.950 3.465 N ETF1 n/a
11 TRCN0000145345 GCCATTACATCTGTACAACAA pLKO.1 356 CDS 100% 4.950 3.465 N ETF1 n/a
12 TRCN0000145405 GCTGTTCTTTACTGACTTGAT pLKO.1 2753 3UTR 100% 4.950 3.465 N ETF1 n/a
13 TRCN0000139839 CCAGATTTCACGAGTGGCAAA pLKO.1 265 CDS 100% 4.050 2.835 N ETF1 n/a
14 TRCN0000142136 GCACAAATTCACTGTGGATCT pLKO.1 643 CDS 100% 4.050 2.835 N ETF1 n/a
15 TRCN0000338749 GCACAAATTCACTGTGGATCT pLKO_005 643 CDS 100% 4.050 2.835 N ETF1 n/a
16 TRCN0000139490 CGGATGAGTTTGGAACTGCAT pLKO.1 294 CDS 100% 2.640 1.848 N ETF1 n/a
17 TRCN0000338748 CGGATGAGTTTGGAACTGCAT pLKO_005 294 CDS 100% 2.640 1.848 N ETF1 n/a
18 TRCN0000141821 GCTACGTTGGAAATTGTCACA pLKO.1 1139 CDS 100% 2.640 1.848 N ETF1 n/a
19 TRCN0000189586 CCTCCAAATGGTCTGGTTGTT pLKO.1 401 CDS 100% 4.950 3.465 N Etf1 n/a
20 TRCN0000279074 CCTCCAAATGGTCTGGTTGTT pLKO_005 401 CDS 100% 4.950 3.465 N Etf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009221.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.