Transcript: Human XM_017009341.1

PREDICTED: Homo sapiens cytoplasmic FMR1 interacting protein 2 (CYFIP2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CYFIP2 (26999)
Length:
4243
CDS:
255..4016

Additional Resources:

NCBI RefSeq record:
XM_017009341.1
NBCI Gene record:
CYFIP2 (26999)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009341.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242604 TCATGTACCAGGCTAACTTTG pLKO_005 361 CDS 100% 10.800 15.120 N CYFIP2 n/a
2 TRCN0000244625 CAGCTGTTGGGTAGATCAATT pLKO_005 2517 CDS 100% 13.200 9.240 N CYFIP2 n/a
3 TRCN0000242601 ACAACGACAGCGCCTACTATG pLKO_005 2263 CDS 100% 10.800 7.560 N CYFIP2 n/a
4 TRCN0000180785 GCTGGCTGACATTGTCAACAT pLKO.1 965 CDS 100% 4.950 3.465 N CYFIP2 n/a
5 TRCN0000181001 GCCTCTACCTAATGGATGGAA pLKO.1 1063 CDS 100% 3.000 2.100 N CYFIP2 n/a
6 TRCN0000242603 TGCTGTCCTGGATGAGCTAAA pLKO_005 758 CDS 100% 10.800 6.480 N CYFIP2 n/a
7 TRCN0000097701 CCTGGATTCTAACGGACCATA pLKO.1 2185 CDS 100% 4.950 2.970 N Cyfip2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009341.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.