Transcript: Human XM_017009375.2

PREDICTED: Homo sapiens KIAA0825 (KIAA0825), transcript variant X17, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIAA0825 (285600)
Length:
13819
CDS:
1480..4341

Additional Resources:

NCBI RefSeq record:
XM_017009375.2
NBCI Gene record:
KIAA0825 (285600)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009375.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142249 GTGGAACTGCTTTCCTTCTTA pLKO.1 870 5UTR 100% 5.625 3.938 N KIAA0825 n/a
2 TRCN0000145616 CAAACAACAACTGACTGCTTT pLKO.1 394 5UTR 100% 4.950 3.465 N KIAA0825 n/a
3 TRCN0000141475 CAACCCTAAGTGGAACATCTT pLKO.1 590 5UTR 100% 4.950 3.465 N KIAA0825 n/a
4 TRCN0000144489 CATTTCTCATGGAGACTTGAT pLKO.1 459 5UTR 100% 4.950 3.465 N KIAA0825 n/a
5 TRCN0000144990 GAAACTTACCTGGATACTGTT pLKO.1 1027 5UTR 100% 4.950 3.465 N KIAA0825 n/a
6 TRCN0000142489 GTCAAGTCTATGTGGGATGAT pLKO.1 667 5UTR 100% 4.950 3.465 N KIAA0825 n/a
7 TRCN0000144762 GTGCTTACAACAACTCTTGTT pLKO.1 780 5UTR 100% 4.950 3.465 N KIAA0825 n/a
8 TRCN0000144838 GTGAGCAAATTACAAAGCCAT pLKO.1 715 5UTR 100% 2.640 1.848 N KIAA0825 n/a
9 TRCN0000141728 GTTGGCTAATCTTCTGTGGAA pLKO.1 855 5UTR 100% 2.640 1.848 N KIAA0825 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009375.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.