Transcript: Human XM_017009495.2

PREDICTED: Homo sapiens peptidylglycine alpha-amidating monooxygenase (PAM), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PAM (5066)
Length:
4073
CDS:
447..3422

Additional Resources:

NCBI RefSeq record:
XM_017009495.2
NBCI Gene record:
PAM (5066)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009495.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303414 ATTGGAACATCGATCAGTTAA pLKO_005 2933 CDS 100% 13.200 18.480 N PAM n/a
2 TRCN0000078124 GCCATATTTATTCGGTGGAAA pLKO.1 3147 CDS 100% 4.950 6.930 N PAM n/a
3 TRCN0000078127 GCCTTTAATTGCTGGCATGTA pLKO.1 1025 CDS 100% 4.950 6.930 N PAM n/a
4 TRCN0000307969 GCCTTTAATTGCTGGCATGTA pLKO_005 1025 CDS 100% 4.950 6.930 N PAM n/a
5 TRCN0000078126 CCGTAGTTCCTATTGATTCAT pLKO.1 589 CDS 100% 5.625 4.500 N PAM n/a
6 TRCN0000292094 CCGTAGTTCCTATTGATTCAT pLKO_005 589 CDS 100% 5.625 4.500 N PAM n/a
7 TRCN0000310686 TGATGAAATGTGCAACTTATA pLKO_005 1364 CDS 100% 13.200 9.240 N PAM n/a
8 TRCN0000078123 CCTTTCCCTTTAGCACGTTTA pLKO.1 3473 3UTR 100% 10.800 7.560 N PAM n/a
9 TRCN0000292093 CCTTTCCCTTTAGCACGTTTA pLKO_005 3473 3UTR 100% 10.800 7.560 N PAM n/a
10 TRCN0000078125 CCTAAGAATAACCTGGTGATT pLKO.1 2061 CDS 100% 4.950 3.465 N PAM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009495.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.