Transcript: Human XM_017009720.1

PREDICTED: Homo sapiens ZFP62 zinc finger protein (ZFP62), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZFP62 (643836)
Length:
2921
CDS:
109..2469

Additional Resources:

NCBI RefSeq record:
XM_017009720.1
NBCI Gene record:
ZFP62 (643836)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009720.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107696 GCCTTAAAGTACATAAACGAA pLKO.1 1748 CDS 100% 3.000 4.200 N ZFP62 n/a
2 TRCN0000107697 CAGAAACAACTCAAGCCTTAA pLKO.1 2070 CDS 100% 10.800 7.560 N ZFP62 n/a
3 TRCN0000107698 GAATGCGACATCTGTGGGAAA pLKO.1 952 CDS 100% 4.050 2.835 N ZFP62 n/a
4 TRCN0000107699 CATCTCTCTCTCGAGCCTTAT pLKO.1 1818 CDS 100% 0.000 0.000 N ZFP62 n/a
5 TRCN0000016730 CTGGAGAGAAACCTTATGAAT pLKO.1 1187 CDS 100% 5.625 2.813 Y ZNF345 n/a
6 TRCN0000086300 CAGGAGAGAAACCTTACAAAT pLKO.1 1271 CDS 100% 13.200 6.600 Y Znf41-ps n/a
7 TRCN0000235353 CAGGAGAGAAACCTTACAAAT pLKO_005 1271 CDS 100% 13.200 6.600 Y EG666605 n/a
8 TRCN0000147367 GAATGTGATGAATGTGGGAAA pLKO.1 1204 CDS 100% 4.050 2.025 Y ZNF658B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009720.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.