Transcript: Human XM_017009969.2

PREDICTED: Homo sapiens adhesion G protein-coupled receptor V1 (ADGRV1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADGRV1 (84059)
Length:
18990
CDS:
93..18608

Additional Resources:

NCBI RefSeq record:
XM_017009969.2
NBCI Gene record:
ADGRV1 (84059)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009969.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358235 ATACTAGCCGTGACCTAATTA pLKO_005 2368 CDS 100% 15.000 21.000 N ADGRV1 n/a
2 TRCN0000368559 TCGAACTAATGGCATTGATTT pLKO_005 9791 CDS 100% 13.200 18.480 N ADGRV1 n/a
3 TRCN0000014233 GAGCACACTTTCATATTTGTA pLKO.1 18686 3UTR 100% 5.625 7.875 N ADGRV1 n/a
4 TRCN0000014234 CGGATTTGAATCCACTGCTTT pLKO.1 14777 CDS 100% 4.950 3.960 N ADGRV1 n/a
5 TRCN0000358234 TCGATTCAAGGCCCTACAAAT pLKO_005 9551 CDS 100% 13.200 9.240 N ADGRV1 n/a
6 TRCN0000014237 CCTGCCAATGATGATCCTTAT pLKO.1 7119 CDS 100% 10.800 7.560 N ADGRV1 n/a
7 TRCN0000014236 GCCAAGAGATAGCAATGAATT pLKO.1 2537 CDS 100% 0.000 0.000 N ADGRV1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009969.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.