Transcript: Human XM_017010235.1

PREDICTED: Homo sapiens solute carrier family 26 member 8 (SLC26A8), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC26A8 (116369)
Length:
3458
CDS:
162..3074

Additional Resources:

NCBI RefSeq record:
XM_017010235.1
NBCI Gene record:
SLC26A8 (116369)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010235.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415388 GATGTGTATGTATCGATTAAA pLKO_005 407 CDS 100% 15.000 21.000 N SLC26A8 n/a
2 TRCN0000044194 GCCTATGTATCATCCGTCTAT pLKO.1 2948 CDS 100% 4.950 6.930 N SLC26A8 n/a
3 TRCN0000044195 CGTGCTTACAATCTTTCCCTT pLKO.1 377 CDS 100% 2.640 3.696 N SLC26A8 n/a
4 TRCN0000423602 AGCTCCTTTCTGCTCATATTT pLKO_005 1263 CDS 100% 15.000 10.500 N SLC26A8 n/a
5 TRCN0000415653 GACTGGACATTGGACTAATTA pLKO_005 1663 CDS 100% 15.000 10.500 N SLC26A8 n/a
6 TRCN0000044196 CCTGATTCACTGCTCACATTT pLKO.1 2081 CDS 100% 13.200 9.240 N SLC26A8 n/a
7 TRCN0000431287 CTCCTACCTTATGGGCTATAA pLKO_005 716 CDS 100% 13.200 9.240 N SLC26A8 n/a
8 TRCN0000044193 GCTTCCTGTAACACCAGATTT pLKO.1 1193 CDS 100% 13.200 9.240 N SLC26A8 n/a
9 TRCN0000044197 GCTGACTTTCATCTTTGGGAT pLKO.1 893 CDS 100% 2.640 1.848 N SLC26A8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010235.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.