Transcript: Human XM_017010254.1

PREDICTED: Homo sapiens collagen type XIX alpha 1 chain (COL19A1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COL19A1 (1310)
Length:
11548
CDS:
310..3759

Additional Resources:

NCBI RefSeq record:
XM_017010254.1
NBCI Gene record:
COL19A1 (1310)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010254.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429358 CACAAACTTGGCATTAGTATA pLKO_005 898 CDS 100% 13.200 18.480 N COL19A1 n/a
2 TRCN0000417445 CCAAACTCTTGGTGGATATTA pLKO_005 1635 CDS 100% 15.000 10.500 N COL19A1 n/a
3 TRCN0000117210 CCAGCAAAGCAGGAACTTAAA pLKO.1 1210 CDS 100% 13.200 9.240 N COL19A1 n/a
4 TRCN0000117211 CCGGCTGATGCAGTTTCATTT pLKO.1 3355 CDS 100% 13.200 9.240 N COL19A1 n/a
5 TRCN0000117209 CCTCCTGGAATACAAGGAATA pLKO.1 1612 CDS 100% 10.800 7.560 N COL19A1 n/a
6 TRCN0000117207 GCCTAATTTAAGGCAGGGTTT pLKO.1 5308 3UTR 100% 4.050 2.835 N COL19A1 n/a
7 TRCN0000117208 GCCTGGAAAGTATGATTCCAT pLKO.1 2484 CDS 100% 0.300 0.210 N COL19A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010254.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.