Transcript: Human XM_017010584.2

PREDICTED: Homo sapiens zinc finger protein 292 (ZNF292), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF292 (23036)
Length:
16263
CDS:
6141..13892

Additional Resources:

NCBI RefSeq record:
XM_017010584.2
NBCI Gene record:
ZNF292 (23036)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010584.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218026 GGATGTACTCGAACCTATAAT pLKO_005 9030 CDS 100% 15.000 21.000 N ZNF292 n/a
2 TRCN0000230618 TGAAGGCTGTGACCGTATATA pLKO_005 12500 CDS 100% 15.000 21.000 N ZNF292 n/a
3 TRCN0000230620 CAGCGAGAGGTAGAGGTTATT pLKO_005 15258 3UTR 100% 13.200 18.480 N ZNF292 n/a
4 TRCN0000230617 TGACAAAGGATGCACTATTTA pLKO_005 11461 CDS 100% 15.000 10.500 N ZNF292 n/a
5 TRCN0000230619 CGAATCTCCTCCGACACATTT pLKO_005 12532 CDS 100% 13.200 9.240 N ZNF292 n/a
6 TRCN0000155229 GATCAAGACCATCCTGGCTAA pLKO.1 5864 5UTR 100% 4.050 2.025 Y INTS7 n/a
7 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 487 5UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010584.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.