Transcript: Human XM_017010896.1

PREDICTED: Homo sapiens patched domain containing 4 (PTCHD4), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTCHD4 (442213)
Length:
4671
CDS:
1054..1980

Additional Resources:

NCBI RefSeq record:
XM_017010896.1
NBCI Gene record:
PTCHD4 (442213)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010896.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149816 GAAGTGCCAAACAGCAAAGAT pLKO.1 1516 CDS 100% 5.625 3.938 N PTCHD4 n/a
2 TRCN0000129218 CTTCTTCATCACCGATGGAAA pLKO.1 1890 CDS 100% 4.950 3.465 N PTCHD4 n/a
3 TRCN0000150149 GAGAATGAGTTCTGTAAGCTT pLKO.1 1627 CDS 100% 3.000 2.100 N PTCHD4 n/a
4 TRCN0000128775 CAGAGCCATTCAAATCACCTA pLKO.1 1554 CDS 100% 2.640 1.848 N PTCHD4 n/a
5 TRCN0000149903 CCACTGAATTTACCTCAAGCT pLKO.1 1958 CDS 100% 2.640 1.848 N PTCHD4 n/a
6 TRCN0000128151 CCAATTTCAAAGTGGACAGAA pLKO.1 3424 3UTR 100% 4.950 2.970 N PTCHD4 n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2972 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2972 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010896.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.