Transcript: Human XM_017011000.1

PREDICTED: Homo sapiens transmembrane protein 63B (TMEM63B), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM63B (55362)
Length:
3522
CDS:
388..2886

Additional Resources:

NCBI RefSeq record:
XM_017011000.1
NBCI Gene record:
TMEM63B (55362)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011000.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155145 GCTCCGTTGACTTTGACCAAA pLKO.1 728 CDS 100% 4.950 6.930 N TMEM63B n/a
2 TRCN0000152282 CAACTTGAAATCAGGGAACAA pLKO.1 975 CDS 100% 4.950 3.960 N TMEM63B n/a
3 TRCN0000156236 CGTCTGCTTTGGACACTTCAA pLKO.1 2568 CDS 100% 4.950 3.960 N TMEM63B n/a
4 TRCN0000374734 ATCAATGGAATCTCCAAATAT pLKO_005 1117 CDS 100% 15.000 10.500 N Tmem63b n/a
5 TRCN0000366212 CTGCTTTCATTAAGGTATTTA pLKO_005 2996 3UTR 100% 15.000 10.500 N Tmem63b n/a
6 TRCN0000151512 CCCTGCTTTCATTAAGGTATT pLKO.1 2994 3UTR 100% 10.800 7.560 N TMEM63B n/a
7 TRCN0000366152 TCTTCGTGAACTACGTCATTG pLKO_005 2090 CDS 100% 10.800 7.560 N Tmem63b n/a
8 TRCN0000151455 CCAAATATGCAGAGTCAGAAA pLKO.1 1130 CDS 100% 4.950 3.465 N TMEM63B n/a
9 TRCN0000155925 CCTGGTAGACAGGTACAATCT pLKO.1 2355 CDS 100% 4.950 3.465 N TMEM63B n/a
10 TRCN0000154771 GAGAACCACCATTGCCAACTT pLKO.1 960 CDS 100% 4.950 3.465 N TMEM63B n/a
11 TRCN0000155102 GAGGGTTAATGAGAGCCAAGA pLKO.1 3176 3UTR 100% 4.050 2.835 N TMEM63B n/a
12 TRCN0000193028 GCCAACTTGAAATCAGGGAAT pLKO.1 973 CDS 100% 4.050 5.670 N Tmem63b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011000.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.