Transcript: Human XM_017011048.1

PREDICTED: Homo sapiens transcriptional regulating factor 1 (TRERF1), transcript variant X20, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRERF1 (55809)
Length:
8059
CDS:
988..4650

Additional Resources:

NCBI RefSeq record:
XM_017011048.1
NBCI Gene record:
TRERF1 (55809)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011048.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047868 CCTTTAGCAAATTACCACTAT pLKO.1 3679 CDS 100% 4.950 6.930 N TRERF1 n/a
2 TRCN0000047871 GCCACTTACAGCAAAGACTTT pLKO.1 3754 CDS 100% 4.950 3.465 N TRERF1 n/a
3 TRCN0000047872 AGGAGGAACAACAGAGGCAAA pLKO.1 4379 CDS 100% 4.050 2.835 N TRERF1 n/a
4 TRCN0000047870 GCTTGAGATTCCAAGCAGAAA pLKO.1 3398 CDS 100% 0.495 0.347 N TRERF1 n/a
5 TRCN0000047869 CAATGCAGATACCTCAGTATT pLKO.1 1946 CDS 100% 13.200 7.920 N TRERF1 n/a
6 TRCN0000095990 CCACGCATCAACATTGGCTTA pLKO.1 3382 CDS 100% 4.050 5.670 N Trerf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011048.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.