Transcript: Human XM_017011084.2

PREDICTED: Homo sapiens LYR motif containing 4 (LYRM4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LYRM4 (57128)
Length:
3951
CDS:
10..399

Additional Resources:

NCBI RefSeq record:
XM_017011084.2
NBCI Gene record:
LYRM4 (57128)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011084.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064083 GCCTACAATTACAGAACATAT pLKO.1 82 CDS 100% 13.200 9.240 N LYRM4 n/a
2 TRCN0000298262 GCCTACAATTACAGAACATAT pLKO_005 82 CDS 100% 13.200 9.240 N LYRM4 n/a
3 TRCN0000294363 TGTAAAGGATCCTGTAGAAAT pLKO_005 144 CDS 100% 13.200 9.240 N LYRM4 n/a
4 TRCN0000294307 CTGAGAGAGAGCAAGCGTTTC pLKO_005 58 CDS 100% 6.000 4.200 N LYRM4 n/a
5 TRCN0000064086 CAGGAGGATAAGAGATGCCTT pLKO.1 108 CDS 100% 2.640 1.848 N LYRM4 n/a
6 TRCN0000064085 CCAAGAGAGACCTTGGAGTAA pLKO.1 185 CDS 100% 0.495 0.297 N LYRM4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011084.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.