Transcript: Human XM_017011245.1

PREDICTED: Homo sapiens utrophin (UTRN), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UTRN (7402)
Length:
8247
CDS:
205..8232

Additional Resources:

NCBI RefSeq record:
XM_017011245.1
NBCI Gene record:
UTRN (7402)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011245.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303379 AGCCGACTGGCTGGTATTAAT pLKO_005 7026 CDS 100% 15.000 21.000 N UTRN n/a
2 TRCN0000303321 CTCATCGTACTTCGGAAATTT pLKO_005 6968 CDS 100% 15.000 21.000 N UTRN n/a
3 TRCN0000054287 CCGACATAAACCTGATCTCTT pLKO.1 882 CDS 100% 4.950 6.930 N UTRN n/a
4 TRCN0000054284 CCTGACAAGAAATCCATAATT pLKO.1 1024 CDS 100% 15.000 10.500 N UTRN n/a
5 TRCN0000054286 CCTGCAAGAATTAAGAGACTT pLKO.1 6666 CDS 100% 4.950 3.465 N UTRN n/a
6 TRCN0000054283 GCCCAGATTGAGGAAGTTCTA pLKO.1 5731 CDS 100% 4.950 3.465 N UTRN n/a
7 TRCN0000292035 GCCCAGATTGAGGAAGTTCTA pLKO_005 5731 CDS 100% 4.950 3.465 N UTRN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011245.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.