Transcript: Human XM_017011483.1

PREDICTED: Homo sapiens major facilitator superfamily domain containing 4B (MFSD4B), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MFSD4B (91749)
Length:
3803
CDS:
423..1862

Additional Resources:

NCBI RefSeq record:
XM_017011483.1
NBCI Gene record:
MFSD4B (91749)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011483.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263280 GGGTCGTGCCTTGGGATATTT pLKO_005 539 CDS 100% 15.000 21.000 N MFSD4B n/a
2 TRCN0000263284 CATCAATAGCTACTGGTATTT pLKO_005 1483 CDS 100% 13.200 18.480 N MFSD4B n/a
3 TRCN0000263281 CCCACAGCTGAAGTCTATAAT pLKO_005 1737 CDS 100% 15.000 10.500 N MFSD4B n/a
4 TRCN0000263283 GTTGGAGCTGAGGTAACATAT pLKO_005 1029 CDS 100% 13.200 9.240 N MFSD4B n/a
5 TRCN0000263282 TGGTCTCATACACGTACAATA pLKO_005 2046 3UTR 100% 13.200 9.240 N MFSD4B n/a
6 TRCN0000172465 CCTGCACTCAACCAATCATCT pLKO.1 783 CDS 100% 4.950 3.465 N MFSD4B n/a
7 TRCN0000166922 CTCACTGACATCTTTGAATAA pLKO.1 1876 3UTR 100% 13.200 7.920 N MFSD4B n/a
8 TRCN0000172951 GCAGGCCTTACACTTCTCTTT pLKO.1 671 CDS 100% 4.950 2.970 N MFSD4B n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2303 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011483.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.