Transcript: Human XM_017011518.1

PREDICTED: Homo sapiens A-kinase anchoring protein 12 (AKAP12), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AKAP12 (9590)
Length:
9794
CDS:
1990..6969

Additional Resources:

NCBI RefSeq record:
XM_017011518.1
NBCI Gene record:
AKAP12 (9590)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011518.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037926 CCAGGCTAATGATATTGGATT pLKO.1 2115 CDS 100% 4.950 6.930 N AKAP12 n/a
2 TRCN0000289648 CCAGGCTAATGATATTGGATT pLKO_005 2115 CDS 100% 4.950 6.930 N AKAP12 n/a
3 TRCN0000308191 GTTTCCACCTGGGAGTCATTT pLKO_005 3886 CDS 100% 13.200 10.560 N AKAP12 n/a
4 TRCN0000037928 GCTACTACCAAGAAAGGCTTA pLKO.1 6088 CDS 100% 4.050 3.240 N AKAP12 n/a
5 TRCN0000289605 GCTACTACCAAGAAAGGCTTA pLKO_005 6088 CDS 100% 4.050 3.240 N AKAP12 n/a
6 TRCN0000296276 TTTCCCTTGATAACCATATAA pLKO_005 7200 3UTR 100% 15.000 10.500 N AKAP12 n/a
7 TRCN0000037924 CCCGAAATAATCGAACAGATT pLKO.1 2047 CDS 100% 4.950 3.465 N AKAP12 n/a
8 TRCN0000037927 GCAAGGTGGATACCTCAGTAT pLKO.1 3632 CDS 100% 4.950 3.465 N AKAP12 n/a
9 TRCN0000289649 GCAAGGTGGATACCTCAGTAT pLKO_005 3632 CDS 100% 4.950 3.465 N AKAP12 n/a
10 TRCN0000037925 CCCAGATACAAATGGACCAAA pLKO.1 6801 CDS 100% 4.950 2.970 N AKAP12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011518.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.