Transcript: Human XM_017011662.2

PREDICTED: Homo sapiens RAS p21 protein activator 4 (RASA4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RASA4 (10156)
Length:
5576
CDS:
69..2453

Additional Resources:

NCBI RefSeq record:
XM_017011662.2
NBCI Gene record:
RASA4 (10156)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011662.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063698 GCCCAGCTAATTCTTGTATTT pLKO.1 4522 3UTR 100% 13.200 6.600 Y RASA4 n/a
2 TRCN0000295885 AGCAACTCTCTGGCCTCAAAG pLKO_005 1098 CDS 100% 10.800 5.400 Y RASA4 n/a
3 TRCN0000267618 GCATCGTGAAGGTGGACAATG pLKO_005 157 CDS 100% 10.800 5.400 Y Rasa4 n/a
4 TRCN0000295831 TCCACGCTGTGGCTTTCTATG pLKO_005 262 CDS 100% 10.800 5.400 Y RASA4 n/a
5 TRCN0000295830 GCCTTACAAGGGACACCATAG pLKO_005 331 CDS 100% 6.000 3.000 Y RASA4 n/a
6 TRCN0000063701 CGCTGGAATGAGACGTTTGAA pLKO.1 603 CDS 100% 5.625 2.813 Y RASA4 n/a
7 TRCN0000307977 CTGGGCAAAGTGGTGATTGAT pLKO_005 702 CDS 100% 5.625 2.813 Y RASA4 n/a
8 TRCN0000063699 CCCATCATCAACAAGGTGTTT pLKO.1 1176 CDS 100% 4.950 2.475 Y RASA4 n/a
9 TRCN0000063700 TGCATCGTGAAGGTGGACAAT pLKO.1 156 CDS 100% 4.950 2.475 Y RASA4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011662.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.