Transcript: Human XM_017011892.2

PREDICTED: Homo sapiens AVL9 cell migration associated (AVL9), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AVL9 (23080)
Length:
6689
CDS:
710..1885

Additional Resources:

NCBI RefSeq record:
XM_017011892.2
NBCI Gene record:
AVL9 (23080)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011892.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136906 CGACACAAGGTCTTAATCCTA pLKO.1 794 CDS 100% 3.000 4.200 N AVL9 n/a
2 TRCN0000137503 CCTCAGAGAGTCTTCCAATTA pLKO.1 1029 CDS 100% 13.200 9.240 N AVL9 n/a
3 TRCN0000134130 CCACAGTATTTGGTATCTCTT pLKO.1 489 5UTR 100% 4.950 3.465 N AVL9 n/a
4 TRCN0000137046 CCTAACTGAAAGTCCTCCTAT pLKO.1 3149 3UTR 100% 4.950 3.465 N AVL9 n/a
5 TRCN0000134010 CCTCTGTATGGTTTACTTCAA pLKO.1 605 5UTR 100% 4.950 3.465 N AVL9 n/a
6 TRCN0000138785 GCACACAACTACCAGGAAGAT pLKO.1 428 5UTR 100% 4.950 3.465 N AVL9 n/a
7 TRCN0000136667 GCAGAGAAATAGCAGAGTGAT pLKO.1 2573 3UTR 100% 4.950 3.465 N AVL9 n/a
8 TRCN0000137186 GCCACACTGCAATTAGACAAT pLKO.1 1493 CDS 100% 4.950 3.465 N AVL9 n/a
9 TRCN0000134240 GCAATATACTTTGGCAGCAAA pLKO.1 5028 3UTR 100% 4.950 2.970 N AVL9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011892.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.