Transcript: Human XM_017011902.1

PREDICTED: Homo sapiens IQ motif containing E (IQCE), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IQCE (23288)
Length:
6927
CDS:
252..2360

Additional Resources:

NCBI RefSeq record:
XM_017011902.1
NBCI Gene record:
IQCE (23288)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011902.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275208 TCCGATGATTCCGACGATATT pLKO_005 2298 CDS 100% 13.200 18.480 N IQCE n/a
2 TRCN0000130906 GATATTGTCATTGCACCGTCT pLKO.1 2313 CDS 100% 2.160 3.024 N IQCE n/a
3 TRCN0000275209 AGAACGATGATACCTACTTAA pLKO_005 2449 3UTR 100% 13.200 9.240 N IQCE n/a
4 TRCN0000129794 CACGAAGAACTTTCCAGTTTA pLKO.1 2339 CDS 100% 13.200 9.240 N IQCE n/a
5 TRCN0000127910 CAAACTCCAGACCGATATGAA pLKO.1 974 CDS 100% 5.625 3.938 N IQCE n/a
6 TRCN0000275210 CAAACTCCAGACCGATATGAA pLKO_005 974 CDS 100% 5.625 3.938 N IQCE n/a
7 TRCN0000127783 GAAGGTGTACAAGCACAAGAA pLKO.1 1862 CDS 100% 4.950 3.465 N IQCE n/a
8 TRCN0000275266 GAAGGTGTACAAGCACAAGAA pLKO_005 1862 CDS 100% 4.950 3.465 N IQCE n/a
9 TRCN0000130836 GATTCAGACACTTACCAGCAA pLKO.1 1628 CDS 100% 2.640 1.848 N IQCE n/a
10 TRCN0000275267 GATTCAGACACTTACCAGCAA pLKO_005 1628 CDS 100% 2.640 1.848 N IQCE n/a
11 TRCN0000129356 CAAGTTCTGAAACCACCGGAA pLKO.1 1072 CDS 100% 2.160 1.512 N IQCE n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011902.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.