Transcript: Human XM_017012047.2

PREDICTED: Homo sapiens growth factor receptor bound protein 10 (GRB10), transcript variant X18, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRB10 (2887)
Length:
7721
CDS:
3092..4837

Additional Resources:

NCBI RefSeq record:
XM_017012047.2
NBCI Gene record:
GRB10 (2887)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012047.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336620 GATGACGGGAACACCAAATTC pLKO_005 4724 CDS 100% 13.200 18.480 N GRB10 n/a
2 TRCN0000063683 CCCTGGAATAATCTTGACAAT pLKO.1 5172 3UTR 100% 4.950 6.930 N GRB10 n/a
3 TRCN0000271640 CATGGCCAGTGAGAGTAAATT pLKO_005 3760 CDS 100% 15.000 10.500 N GRB10 n/a
4 TRCN0000370678 ATGCTCCTTTACCAGAATTAC pLKO_005 4253 CDS 100% 13.200 9.240 N GRB10 n/a
5 TRCN0000271636 GGAATCCCACAGGATCATTAA pLKO_005 4555 CDS 100% 13.200 9.240 N GRB10 n/a
6 TRCN0000271642 GCAGTCAAATGGCAGTCAAAC pLKO_005 3865 CDS 100% 10.800 7.560 N GRB10 n/a
7 TRCN0000370751 GTTGGACTTAAACGACGATTT pLKO_005 4992 3UTR 100% 10.800 7.560 N GRB10 n/a
8 TRCN0000063685 GCCCTGGTGAACGATATGAAT pLKO.1 3077 5UTR 100% 5.625 3.938 N GRB10 n/a
9 TRCN0000063686 CCAGAGTAATCCAAAGGCATT pLKO.1 4618 CDS 100% 4.050 2.835 N GRB10 n/a
10 TRCN0000063684 CCCATGAATTTCTTCCCAGAA pLKO.1 3824 CDS 100% 4.050 2.835 N GRB10 n/a
11 TRCN0000370697 AGACCACGGGCTCTGCATAAA pLKO_005 4126 CDS 100% 13.200 7.920 N GRB10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012047.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.