Transcript: Human XM_017012212.1

PREDICTED: Homo sapiens karyopherin subunit alpha 7 (KPNA7), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KPNA7 (402569)
Length:
1958
CDS:
147..1712

Additional Resources:

NCBI RefSeq record:
XM_017012212.1
NBCI Gene record:
KPNA7 (402569)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012212.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337029 GCCTCACTCTGGGTGAAATAA pLKO_005 352 CDS 100% 15.000 12.000 N KPNA7 n/a
2 TRCN0000336961 CACATCTCCTAGCCTTGATTT pLKO_005 748 CDS 100% 13.200 10.560 N KPNA7 n/a
3 TRCN0000336959 GCTGCATGAGAACCGTCAAAT pLKO_005 1547 CDS 100% 13.200 9.240 N KPNA7 n/a
4 TRCN0000336960 TCAGATCCAGTCCTATGTTTC pLKO_005 390 CDS 100% 10.800 7.560 N KPNA7 n/a
5 TRCN0000233986 CCCAGCTCCTGCAACACAAAT pLKO_005 1138 CDS 100% 13.200 6.600 Y Smarce1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012212.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.