Transcript: Human XM_017012289.1

PREDICTED: Homo sapiens platelet derived growth factor subunit A (PDGFA), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PDGFA (5154)
Length:
2055
CDS:
38..712

Additional Resources:

NCBI RefSeq record:
XM_017012289.1
NBCI Gene record:
PDGFA (5154)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012289.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022330 AGGACGGTCATTTACGAGATT pLKO.1 371 CDS 100% 4.950 6.930 N LOC377602 n/a
2 TRCN0000158260 CAGGACGGTCATTTACGAGAT pLKO.1 370 CDS 100% 4.050 5.670 N PDGFA n/a
3 TRCN0000156591 GAATCCGGATTATCGGGAAGA pLKO.1 628 CDS 100% 4.050 5.670 N PDGFA n/a
4 TRCN0000156443 CGGTCATTTACGAGATTCCTC pLKO.1 375 CDS 100% 2.640 3.696 N PDGFA n/a
5 TRCN0000157341 CTGAATCCGGATTATCGGGAA pLKO.1 626 CDS 100% 2.160 3.024 N PDGFA n/a
6 TRCN0000022333 CAAGACCAGGACGGTCATTTA pLKO.1 364 CDS 100% 13.200 10.560 N LOC377602 n/a
7 TRCN0000339543 CAAGACCAGGACGGTCATTTA pLKO_005 364 CDS 100% 13.200 10.560 N Pdgfa n/a
8 TRCN0000157845 CACAAGCCTGAATCCGGATTA pLKO.1 619 CDS 100% 10.800 7.560 N PDGFA n/a
9 TRCN0000157428 GTGAGGTTAGAGGAGCATTTG pLKO.1 581 CDS 100% 10.800 7.560 N PDGFA n/a
10 TRCN0000022329 CGTAGGGAGTGAGGATTCTTT pLKO.1 232 CDS 100% 5.625 3.938 N LOC377602 n/a
11 TRCN0000158353 CAAGGTGGAATACGTCAGGAA pLKO.1 535 CDS 100% 2.640 1.848 N PDGFA n/a
12 TRCN0000157461 GTGAGGATTCTTTGGACACCA pLKO.1 240 CDS 100% 2.640 1.848 N PDGFA n/a
13 TRCN0000022332 CCGCAGTCAGATCCACAGCAT pLKO.1 178 CDS 100% 0.880 0.616 N LOC377602 n/a
14 TRCN0000158199 CATTCGGAGGAAGAGAAGCAT pLKO.1 319 CDS 100% 3.000 1.800 N PDGFA n/a
15 TRCN0000065689 AGGACGGTCATTTACGAGATA pLKO.1 371 CDS 100% 4.950 6.930 N Pdgfa n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012289.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.