Transcript: Human XM_017012412.2

PREDICTED: Homo sapiens VPS50 subunit of EARP/GARPII complex (VPS50), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VPS50 (55610)
Length:
4351
CDS:
2031..3761

Additional Resources:

NCBI RefSeq record:
XM_017012412.2
NBCI Gene record:
VPS50 (55610)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012412.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433766 GAGGCGTATAGAGACAAATTG pLKO_005 355 5UTR 100% 13.200 18.480 N VPS50 n/a
2 TRCN0000417837 AGTTTAGGCCTTCTTGCAAAT pLKO_005 1250 5UTR 100% 10.800 15.120 N VPS50 n/a
3 TRCN0000127695 GCAAAGAACAGATGTACGGTT pLKO.1 1410 5UTR 100% 2.640 3.696 N VPS50 n/a
4 TRCN0000179049 CCCATCAGTTTCACCTAGTAA pLKO.1 2348 CDS 100% 5.625 4.500 N Vps50 n/a
5 TRCN0000427490 AGCTGAACAAGAGCTTATTAA pLKO_005 240 5UTR 100% 15.000 10.500 N VPS50 n/a
6 TRCN0000427551 GAAATCTCTGAGAACTATAAA pLKO_005 1303 5UTR 100% 15.000 10.500 N VPS50 n/a
7 TRCN0000425899 AGCAATGGATCAACTTCATAT pLKO_005 1674 5UTR 100% 13.200 9.240 N VPS50 n/a
8 TRCN0000130854 GCTTCCACCTGTTCTCAATTT pLKO.1 324 5UTR 100% 13.200 9.240 N VPS50 n/a
9 TRCN0000433341 TTCTGTGGATTCATTTGATAT pLKO_005 282 5UTR 100% 13.200 9.240 N VPS50 n/a
10 TRCN0000426268 CCATTCACAACACCGTGTTTC pLKO_005 1709 5UTR 100% 10.800 7.560 N VPS50 n/a
11 TRCN0000131003 CCTCAAGAAAGCCTCAGTGAT pLKO.1 142 5UTR 100% 4.950 3.465 N VPS50 n/a
12 TRCN0000130542 GCAAGATACTTTGGAACAGAT pLKO.1 1548 5UTR 100% 4.950 3.465 N VPS50 n/a
13 TRCN0000130729 GCTATTCAGTTGTGCCTTGAA pLKO.1 1465 5UTR 100% 4.950 3.465 N VPS50 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012412.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.