Transcript: Human XM_017012628.1

PREDICTED: Homo sapiens cilia and flagella associated protein 69 (CFAP69), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CFAP69 (79846)
Length:
3003
CDS:
231..2912

Additional Resources:

NCBI RefSeq record:
XM_017012628.1
NBCI Gene record:
CFAP69 (79846)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012628.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263545 TACCTACTGTACAGCTATTAA pLKO_005 1372 CDS 100% 0.000 0.000 N CFAP69 n/a
2 TRCN0000282693 CAGCTTAGAAATGACATATTA pLKO_005 1149 CDS 100% 15.000 10.500 N CFAP69 n/a
3 TRCN0000263546 GCAAAGAGAGCTGGCTAATAA pLKO_005 2513 CDS 100% 15.000 10.500 N CFAP69 n/a
4 TRCN0000263544 AGAGTGGCTTAGGCTATAATG pLKO_005 1954 CDS 100% 13.200 9.240 N CFAP69 n/a
5 TRCN0000263547 CGGAACTGAAGGAGTAGATAT pLKO_005 1895 CDS 100% 13.200 9.240 N CFAP69 n/a
6 TRCN0000369636 TTCAAGCCTATGGACCTTAAT pLKO_005 357 CDS 100% 13.200 9.240 N CFAP69 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012628.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08967 pDONR223 100% 91.1% 91% None (many diffs) n/a
Download CSV