Transcript: Human XM_017012833.2

PREDICTED: Homo sapiens TRPM8 channel associated factor 1 (TCAF1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TCAF1 (9747)
Length:
5698
CDS:
150..2909

Additional Resources:

NCBI RefSeq record:
XM_017012833.2
NBCI Gene record:
TCAF1 (9747)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012833.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365022 ACCGCACTGGAAACGTATTTA pLKO_005 2631 CDS 100% 15.000 21.000 N TCAF1 n/a
2 TRCN0000172753 CCGAGAGAACCCTGTTATCAA pLKO.1 1583 CDS 100% 5.625 7.875 N TCAF1 n/a
3 TRCN0000172681 GCAACTCGGATTGTTTCCCAT pLKO.1 835 CDS 100% 2.640 3.696 N TCAF1 n/a
4 TRCN0000377377 ACATACCTGGAAGGCAAATTA pLKO_005 1798 CDS 100% 15.000 12.000 N TCAF1 n/a
5 TRCN0000365069 GGCCGAGTTCCAGGTTATAAT pLKO_005 1403 CDS 100% 15.000 10.500 N TCAF1 n/a
6 TRCN0000370055 CAATCCAGGCACCAGATATTG pLKO_005 1757 CDS 100% 13.200 9.240 N TCAF1 n/a
7 TRCN0000370056 CCACTATTGATACCAGTTAAA pLKO_005 3235 3UTR 100% 13.200 9.240 N TCAF1 n/a
8 TRCN0000416548 TTCTCTTCTAGTGGAAATAAG pLKO_005 3347 3UTR 100% 13.200 9.240 N TCAF1 n/a
9 TRCN0000172405 CCAGGTTATAATGGGCAGGAA pLKO.1 1412 CDS 100% 2.640 1.848 N TCAF1 n/a
10 TRCN0000167444 GCATGATAATGAAAGAGTGAA pLKO.1 3059 3UTR 100% 4.950 2.970 N TCAF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012833.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.