Transcript: Human XM_017012976.1

PREDICTED: Homo sapiens ADAM metallopeptidase domain 28 (ADAM28), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADAM28 (10863)
Length:
6996
CDS:
390..2537

Additional Resources:

NCBI RefSeq record:
XM_017012976.1
NBCI Gene record:
ADAM28 (10863)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012976.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431276 TCAAGGTGGGTCGGATAATTT pLKO_005 1907 CDS 100% 15.000 21.000 N ADAM28 n/a
2 TRCN0000427299 TGTTCCCAATGGCGGTCATTT pLKO_005 2224 CDS 100% 13.200 18.480 N ADAM28 n/a
3 TRCN0000051518 GCAAGAACTAATGGCTAAATT pLKO.1 2550 3UTR 100% 15.000 10.500 N ADAM28 n/a
4 TRCN0000432567 GTATTTGAGATGGCTAATTAT pLKO_005 900 CDS 100% 15.000 10.500 N ADAM28 n/a
5 TRCN0000051521 CCTGGATAATGGTGAGTTTAA pLKO.1 842 CDS 100% 13.200 9.240 N ADAM28 n/a
6 TRCN0000051522 CGTCTCAGCTATGACAAGTTT pLKO.1 1347 CDS 100% 5.625 3.938 N ADAM28 n/a
7 TRCN0000051520 GCCCACAAATTATGGATGATT pLKO.1 502 CDS 100% 5.625 3.938 N ADAM28 n/a
8 TRCN0000051519 GCCTGAAATGTGTAATGGTAA pLKO.1 1631 CDS 100% 4.950 3.465 N ADAM28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012976.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.